blastxmlparser is listed at biogems.info
bio-blastxmlparser
blastxmlparser is a very fast big-data BLAST XML file parser, which can be used as command line utility, or as a Ruby library. Rather than loading everything in memory, XML is parsed by BLAST query (Iteration). Not only has this the advantage of low memory use, it also shows results early, and it may be faster when IO continues in parallel (disk read-ahead).
Next to the API, blastxmlparser comes as a command line utility, which can be used to filter results and requires no understanding of Ruby.
Quick start
gem install bio-blastxmlparser
blastxmlparser --help
(see Installation, below, if it does not work)
Performance
XML parsing is expensive. blastxmlparser uses the fast Nokogiri C, or Java, XML parsers, based on libxml2. Basically, a DOM parser is used for subsections of a document. Tests show this is faster than a SAX parser with Ruby callbacks. To see why libxml2 based Nokogiri is fast, see www.rubyinside.com/ruby-xml-performance-benchmarks-1641.html and www.xml.com/lpt/a/1703.
The parser is also designed with other optimizations, such as lazy evaluation, i.e. only creating objects when required, and (in a future version) parallelization. When parsing a full BLAST result usually only a few fields are used. By using XPath queries only the relevant fields are queried.
Timings for parsing test/data/nt_example_blastn.m7 (file size 3.4Mb)
bio-blastxmlparser + Nokogiri DOM (default)
real 0m1.259s
user 0m1.052s
sys 0m0.144s
bio-blastxmlparser + Nokogiri split DOM
real 0m1.713s
user 0m1.444s
sys 0m0.160s
BioRuby ReXML DOM parser (old style)
real 1m14.548s
user 1m13.065s
sys 0m0.472s
Install
gem install bio-blastxmlparser
Important: the parser is written for Ruby >= 1.9. You can check with
ruby -v
gem env
Nokogiri XML parser is required. To install it, the libxml2 libraries and headers need to be installed first, for example on Debian:
apt-get install libxslt-dev libxml2-dev
gem install bio-blastxmlparser
for more installation on other platforms see nokogiri.org/tutorials/installing_nokogiri.html.
Command line usage
Usage
blastxmlparser [options] file(s)
-p, --parser name Use full|split parser (default full)
--output-fasta Output FASTA
-n, --named fields Set named fields
-e, --exec filter Execute filter
--logger filename Log to file (default stderr)
--trace options Set log level (default INFO, see bio-logger)
-q, --quiet Run quietly
-v, --verbose Run verbosely
--debug Show debug messages
-h, --help Show help and examples
bioblastxmlparser filename(s)
Use --help switch for more information
Examples
Print result fields of iterations containing ‘lcl’, using a regex
blastxmlparser -e 'iter.query_id=~/lcl/' test/data/nt_example_blastn.m7
Print fields where bit_score > 145
blastxmlparser -e 'hsp.bit_score>145' test/data/nt_example_blastn.m7
prints a tab delimited
1 1 lcl|1_0 lcl|I_74685 1 5.82208e-34
2 1 lcl|1_0 lcl|I_1 1 5.82208e-34
3 2 lcl|2_0 lcl|I_2 1 6.05436e-59
4 3 lcl|3_0 lcl|I_3 1 2.03876e-56
The second and third column show the BLAST iteration, and the others relate to the hits.
As this is evaluated Ruby, it is also possible to use the XML element names directly
blastxmlparser -e 'hsp["Hsp_bit-score"].to_i>145' test/data/nt_example_blastn.m7
And it is possible to print (non default) named fields where E-value < 0.001 and hit length > 100. E.g.
blastxmlparser -n 'hsp.evalue,hsp.qseq' -e 'hsp.evalue<0.01 and hit.len>100' test/data/nt_example_blastn.m7
1 5.82208e-34 AGTGAAGCTTCTAGATATTTGGCGGGTACCTCTAATTTTGCCT...
2 5.82208e-34 AGTGAAGCTTCTAGATATTTGGCGGGTACCTCTAATTTTGCCT...
3 2.76378e-11 AATATGGTAGCTACAGAAACGGTAGTACACTCTTC
4 1.13373e-13 CTAAACACAGGAGCATATAGGTTGGCAGGCAGGCAAAAT
5 2.76378e-11 GAAGAGTGTACTACCGTTTCTGTAGCTACCATATT
etc. etc.
prints the evalue and qseq columns. To output FASTA use –output-fasta
blastxmlparser --output-fasta -e 'hsp.evalue<0.01 and hit.len>100' test/data/nt_example_blastn.m7
which prints matching sequences, where the first field is the accession, followed by query iteration id, and hit_id. E.g.
>I_74685 1|lcl|1_0 lcl|I_74685 [57809 - 57666] (REVERSE SENSE)
AGTGAAGCTTCTAGATATTTGGCGGGTACCTCTAATTTTGCCTGCCTGCCAACCTATATGCTCCTGTGTTTAG
>I_1 1|lcl|1_0 lcl|I_1 [477 - 884]
AGTGAAGCTTCTAGATATTTGGCGGGTACCTCTAATTTTGCCTGCCTGCCAACCTATATGCTCCTGTGTTTAG
etc. etc.
To use the low-mem (iterated slower) version of the parser use
blastxmlparser --parser split -n 'hsp.evalue,hsp.qseq' -e 'hsp.evalue<0.01 and hit.len>100' test/data/nt_example_blastn.m7
API (Ruby library)
To loop through a BLAST result:
>> require 'bio-blastxmlparser'
>> fn = 'test/data/nt_example_blastn.m7'
>> n = Bio::BlastXMLParser::XmlIterator.new(fn).to_enum
>> n.each do | iter |
>> puts "Hits for " + iter.query_id
>> iter.each do | hit |
>> hit.each do | hsp |
>> print hit.hit_id, "\t", hsp.evalue, "\n" if hsp.evalue < 0.001
>> end
>> end
>> end
The next example parses XML using less memory by using a Ruby Iterator
>> blast = Bio::BlastXMLParser::XmlSplitterIterator.new(fn).to_enum
>> iter = blast.next
>> iter.iter_num
=> 1
>> iter.query_id
=> "lcl|1_0"
Get the first hit
>> hit = iter.hits.first
>> hit.hit_num
=> 1
>> hit.hit_id
=> "lcl|I_74685"
>> hit.hit_def
=> "[57809 - 57666] (REVERSE SENSE) "
>> hit.accession
=> "I_74685"
>> hit.len
=> 144
Get the parent info
>> hit.parent.query_id
=> "lcl|1_0"
Get the first Hsp
>> hsp = hit.hsps.first
>> hsp.hsp_num
=> 1
>> hsp.bit_score
=> 145.205
>> hsp.score
=> 73
>> hsp.evalue
=> 5.82208e-34
>> hsp.query_from
=> 28
>> hsp.query_to
=> 100
>> hsp.query_frame
=> 1
>> hsp.hit_frame
=> 1
>> hsp.identity
=> 73
>> hsp.positive
=> 73
>> hsp.align_len
=> 73
>> hsp.qseq
=> "AGTGAAGCTTCTAGATATTTGGCGGGTACCTCTAATTTTGCCTGCCTGCCAACCTATATGCTCCTGTGTTTAG"
>> hsp.hseq
=> "AGTGAAGCTTCTAGATATTTGGCGGGTACCTCTAATTTTGCCTGCCTGCCAACCTATATGCTCCTGTGTTTAG"
>> hsp.midline
=> "|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||"
Unlike BioRuby, this module uses the actual element names in the XML definition, to avoid confusion (if anyone wants a translation, feel free to contribute an adaptor).
It is also possible to use the XML element names as Strings, rather than methods. E.g.
>> hsp.field("Hsp_bit-score")
=> "145.205"
>> hsp["Hsp_bit-score"]
=> "145.205"
Note that, when using the element names, the results are always String values.
Fetch the next result (Iteration)
>> iter2 = blast.next
>> iter2.iter_num
>> 2
>> iter2.query_id
=> "lcl|2_0"
etc. etc.
For more examples see the files in ./spec
URL
The project lives at github.com/pjotrp/blastxmlparser. If you use this software, please cite dx.doi.org/10.1093/bioinformatics/btq475
Copyright
Copyright © 2011,2012 Pjotr Prins under the MIT licence. See LICENSE.txt and www.opensource.org/licenses/mit-license.html for further details.