Ensembl Rest
A Ruby library for the RESTful Ensembl API.
Obtaining
gem install bio-ensembl-rest
for the repository:
git clone git://github.com/ALTree/bio-ensembl-rest
Usage
Each of the endpoint group listed in the Ensembl REST documentation has its own ruby module with the same name (except for Ontologies and Taxonomy, wich is split in two modules).
A full list of modules and methods, with documentation, is available here.
To make a request to an endpoint, use the appropriate method in the relative module. For example, to access the sequence/region/:species/:region
endpoint in the Sequence group, use the sequence_region
method in the Sequence
module:
require 'bio-ensembl-rest'
include EnsemblRest
EnsemblRest.connect_db # connect to database
puts Sequence.sequence_region 'Homo sapiens', 'X:1000000..1000025:1'
# GAAACAGCTACTTGGAAGGCTGAAGC
Documentation
See the ensembl-rest wiki page.
Known issues
version-specific issues
On jruby, methods in the ComparativeGenomics module fail if called with
response: ruby
, due to a C dependency in the 'bio' gem.On rubinius, methods in the ComparativeGenomics module fail if called with
response: ruby
, due to a C dependency in the 'bio' gem.