Class: Bio::FastaFormat
Overview
Treats a FASTA formatted entry, such as:
>id and/or some comments <== comment line
ATGCATGCATGCATGCATGCATGCATGCATGCATGC <== sequence lines
ATGCATGCATGCATGCATGCATGCATGCATGCATGC
ATGCATGCATGC
The precedent ‘>’ can be omitted and the trailing ‘>’ will be removed automatically.
Examples
f_str = ">sce:YBR160W CDC28, SRM5; cyclin-dependent protein kinase catalytic subunit [EC:2.7.1.-] [SP:CC28_YEAST]\nMSGELANYKRLEKVGEGTYGVVYKALDLRPGQGQRVVALKKIRLESEDEG\nVPSTAIREISLLKELKDDNIVRLYDIVHSDAHKLYLVFEFLDLDLKRYME\nGIPKDQPLGADIVKKFMMQLCKGIAYCHSHRILHRDLKPQNLLINKDGNL\nKLGDFGLARAFGVPLRAYTHEIVTLWYRAPEVLLGGKQYSTGVDTWSIGC\nIFAEMCNRKPIFSGDSEIDQIFKIFRVLGTPNEAIWPDIVYLPDFKPSFP\nQWRRKDLSQVVPSLDPRGIDLLDKLLAYDPINRISARRAAIHPYFQES\n>sce:YBR274W CHK1; probable serine/threonine-protein kinase [EC:2.7.1.-] [SP:KB9S_YEAST]\nMSLSQVSPLPHIKDVVLGDTVGQGAFACVKNAHLQMDPSIILAVKFIHVP\nTCKKMGLSDKDITKEVVLQSKCSKHPNVLRLIDCNVSKEYMWIILEMADG\nGDLFDKIEPDVGVDSDVAQFYFQQLVSAINYLHVECGVAHRDIKPENILL\nDKNGNLKLADFGLASQFRRKDGTLRVSMDQRGSPPYMAPEVLYSEEGYYA\nDRTDIWSIGILLFVLLTGQTPWELPSLENEDFVFFIENDGNLNWGPWSKI\nEFTHLNLLRKILQPDPNKRVTLKALKLHPWVLRRASFSGDDGLCNDPELL\nAKKLFSHLKVSLSNENYLKFTQDTNSNNRYISTQPIGNELAELEHDSMHF\nQTVSNTQRAFTSYDSNTNYNSGTGMTQEAKWTQFISYDIAALQFHSDEND\nCNELVKRHLQFNPNKLTKFYTLQPMDVLLPILEKALNLSQIRVKPDLFAN\nFERLCELLGYDNVFPLIINIKTKSNGGYQLCGSISIIKIEEELKSVGFER\nKTGDPLEWRRLFKKISTICRDIILIPN\n"
f = Bio::FastaFormat.new(f_str)
puts "### FastaFormat"
puts "# entry"
puts f.entry
puts "# entry_id"
p f.entry_id
puts "# definition"
p f.definition
puts "# data"
p f.data
puts "# seq"
p f.seq
puts "# seq.type"
p f.seq.type
puts "# length"
p f.length
puts "# aaseq"
p f.aaseq
puts "# aaseq.type"
p f.aaseq.type
puts "# aaseq.composition"
p f.aaseq.composition
puts "# aalen"
p f.aalen
References
-
FASTA format (WikiPedia) en.wikipedia.org/wiki/FASTA_format
Direct Known Subclasses
Constant Summary collapse
- DELIMITER =
Entry delimiter in flatfile text.
RS = "\n>"
- DELIMITER_OVERRUN =
(Integer) excess read size included in DELIMITER.
1
Instance Attribute Summary collapse
-
#data ⇒ Object
The seuqnce lines in text.
-
#definition ⇒ Object
The comment line of the FASTA formatted data.
-
#entry_overrun ⇒ Object
readonly
Returns the value of attribute entry_overrun.
Instance Method Summary collapse
-
#aalen ⇒ Object
Returens the length of Bio::Sequence::AA.
-
#aaseq ⇒ Object
Returens the Bio::Sequence::AA.
-
#acc_version ⇒ Object
Returns accession number with version.
-
#accession ⇒ Object
Returns an accession number.
-
#accessions ⇒ Object
Parsing FASTA Defline (using #identifiers method), and shows accession numbers.
-
#comment ⇒ Object
Returns comments.
-
#entry ⇒ Object
(also: #to_s)
Returns the stored one entry as a FASTA format.
-
#entry_id ⇒ Object
Parsing FASTA Defline (using #identifiers method), and shows a possibly unique identifier.
-
#gi ⇒ Object
Parsing FASTA Defline (using #identifiers method), and shows GI/locus/accession/accession with version number.
-
#identifiers ⇒ Object
Parsing FASTA Defline, and extract IDs.
-
#initialize(str) ⇒ FastaFormat
constructor
Stores the comment and sequence information from one entry of the FASTA format string.
-
#length ⇒ Object
Returns sequence length.
-
#locus ⇒ Object
Returns locus.
-
#nalen ⇒ Object
Returens the length of Bio::Sequence::NA.
-
#naseq ⇒ Object
Returens the Bio::Sequence::NA.
-
#query(factory) ⇒ Object
(also: #fasta, #blast)
Executes FASTA/BLAST search by using a Bio::Fasta or a Bio::Blast factory object.
-
#seq ⇒ Object
Returns a joined sequence line as a String.
-
#to_seq ⇒ Object
Returns sequence as a Bio::Sequence object.
Methods inherited from DB
#exists?, #fetch, #get, open, #tags
Constructor Details
#initialize(str) ⇒ FastaFormat
Stores the comment and sequence information from one entry of the FASTA format string. If the argument contains more than one entry, only the first entry is used.
155 156 157 158 159 160 |
# File 'lib/bio/db/fasta.rb', line 155 def initialize(str) @definition = str[/.*/].sub(/^>/, '').strip # 1st line @data = str.sub(/.*/, '') # rests @data.sub!(/^>.*/m, '') # remove trailing entries for sure @entry_overrun = $& end |
Instance Attribute Details
#data ⇒ Object
The seuqnce lines in text.
148 149 150 |
# File 'lib/bio/db/fasta.rb', line 148 def data @data end |
#definition ⇒ Object
The comment line of the FASTA formatted data.
145 146 147 |
# File 'lib/bio/db/fasta.rb', line 145 def definition @definition end |
#entry_overrun ⇒ Object (readonly)
Returns the value of attribute entry_overrun.
150 151 152 |
# File 'lib/bio/db/fasta.rb', line 150 def entry_overrun @entry_overrun end |
Instance Method Details
#aalen ⇒ Object
Returens the length of Bio::Sequence::AA.
245 246 247 |
# File 'lib/bio/db/fasta.rb', line 245 def aalen self.aaseq.length end |
#aaseq ⇒ Object
Returens the Bio::Sequence::AA.
240 241 242 |
# File 'lib/bio/db/fasta.rb', line 240 def aaseq Sequence::AA.new(seq) end |
#acc_version ⇒ Object
Returns accession number with version.
303 304 305 |
# File 'lib/bio/db/fasta.rb', line 303 def acc_version identifiers.acc_version end |
#accession ⇒ Object
Returns an accession number.
291 292 293 |
# File 'lib/bio/db/fasta.rb', line 291 def accession identifiers.accession end |
#accessions ⇒ Object
Parsing FASTA Defline (using #identifiers method), and shows accession numbers. It returns an array of strings.
298 299 300 |
# File 'lib/bio/db/fasta.rb', line 298 def accessions identifiers.accessions end |
#comment ⇒ Object
Returns comments.
219 220 221 222 |
# File 'lib/bio/db/fasta.rb', line 219 def comment seq @comment end |
#entry ⇒ Object Also known as: to_s
Returns the stored one entry as a FASTA format. (same as to_s)
163 164 165 |
# File 'lib/bio/db/fasta.rb', line 163 def entry @entry = ">#{@definition}\n#{@data.strip}\n" end |
#entry_id ⇒ Object
Parsing FASTA Defline (using #identifiers method), and shows a possibly unique identifier. It returns a string.
277 278 279 |
# File 'lib/bio/db/fasta.rb', line 277 def entry_id identifiers.entry_id end |
#gi ⇒ Object
Parsing FASTA Defline (using #identifiers method), and shows GI/locus/accession/accession with version number. If a entry has more than two of such IDs, only the first ID are shown. It returns a string or nil.
286 287 288 |
# File 'lib/bio/db/fasta.rb', line 286 def gi identifiers.gi end |
#identifiers ⇒ Object
Parsing FASTA Defline, and extract IDs. IDs are NSIDs (NCBI standard FASTA sequence identifiers) or “:”-separated IDs. It returns a Bio::FastaDefline instance.
267 268 269 270 271 272 |
# File 'lib/bio/db/fasta.rb', line 267 def identifiers unless defined?(@ids) then @ids = FastaDefline.new(@definition) end @ids end |
#length ⇒ Object
Returns sequence length.
225 226 227 |
# File 'lib/bio/db/fasta.rb', line 225 def length seq.length end |
#locus ⇒ Object
Returns locus.
308 309 310 |
# File 'lib/bio/db/fasta.rb', line 308 def locus identifiers.locus end |
#nalen ⇒ Object
Returens the length of Bio::Sequence::NA.
235 236 237 |
# File 'lib/bio/db/fasta.rb', line 235 def nalen self.naseq.length end |
#naseq ⇒ Object
Returens the Bio::Sequence::NA.
230 231 232 |
# File 'lib/bio/db/fasta.rb', line 230 def naseq Sequence::NA.new(seq) end |
#query(factory) ⇒ Object Also known as: fasta, blast
Executes FASTA/BLAST search by using a Bio::Fasta or a Bio::Blast factory object.
#!/usr/bin/env ruby
require 'bio'
factory = Bio::Fasta.local('fasta34', 'db/swissprot.f')
flatfile = Bio::FlatFile.open(Bio::FastaFormat, 'queries.f')
flatfile.each do |entry|
p entry.definition
result = entry.fasta(factory)
result.each do |hit|
print "#{hit.query_id} : #{hit.evalue}\t#{hit.target_id} at "
p hit.lap_at
end
end
186 187 188 |
# File 'lib/bio/db/fasta.rb', line 186 def query(factory) factory.query(@entry) end |
#seq ⇒ Object
Returns a joined sequence line as a String.
193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 |
# File 'lib/bio/db/fasta.rb', line 193 def seq unless defined?(@seq) unless /\A\s*^\#/ =~ @data then @seq = Sequence::Generic.new(@data.tr(" \t\r\n0-9", '')) # lazy clean up else a = @data.split(/(^\#.*$)/) i = 0 cmnt = {} s = [] a.each do |x| if /^# ?(.*)$/ =~ x then cmnt[i] ? cmnt[i] << "\n" << $1 : cmnt[i] = $1 else x.tr!(" \t\r\n0-9", '') # lazy clean up i += x.length s << x end end @comment = cmnt @seq = Bio::Sequence::Generic.new(s.join('')) end end @seq end |
#to_seq ⇒ Object
Returns sequence as a Bio::Sequence object.
Note: If you modify the returned Bio::Sequence object, the sequence or definition in this FastaFormat object might also be changed (but not always be changed) because of efficiency.
256 257 258 259 260 261 |
# File 'lib/bio/db/fasta.rb', line 256 def to_seq seq obj = Bio::Sequence.new(@seq) obj.definition = self.definition obj end |